Return to Unfiction unforum
 a.r.g.b.b 
 Calendar Calendar   FAQ FAQ   Search Search   Memberlist Memberlist   Usergroups Usergroups 
 Register Register   Log in Log in 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
This week sponsored by:

You?

Why do we need your help?
Announcements
Your continued support keeps uF running!
 
The time now is Fri Mar 24, 2017 8:00 pm
All times are UTC - 4 (DST in action)
View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Diversions » TimeWasters
Help me for DNA sequence please
Moderators: Giskard, ndemeter, ScarpeGrosse
Post new topic   Reply to topic View previous topicMark the topic unreadView next topic
Page 1 of 1 [3 Posts]  
Author Message
abdmaa01
Kilroy

Joined: 20 Mar 2015
Posts: 2

Help me for DNA sequence please

Hello everyone,

I tried for several days to drill the mystery of DNA as follows:

TATAAATGTATTTTTGTGAGTCGGGTACCCCCTGCGACCCAAATT
CAGATCGGTGTGGTACCCCCTGCGACCCAAATTCAGATGCAGAAGA
TACCCCAATGCCATATGACCCAAATTCAGATCCAACTTATGACCCAC
TGGATGAGGATACCCCAATGCCATATCGGTGTTATTTTTGGTGGGAT
ACCCCAATGCCATATGCAGAACAGTTCCCCTACCAGCAGTTCCCCTA
CCAGTATTTTTGGTGGTAAATGGAACTGGAGGTCGAAAATTAACGAT

This is actually a DNA sequence that contains the LAT and LONG coordinates of a geocache. I tried many things. Without result.
I saw on the forums that this had already been the subject of discussion. Does anyone have a me a while to find this information?
It would be really nice.

PostPosted: Fri Mar 20, 2015 3:58 pm
 View user's profile Send private message
Reply with quote Mark this and the following posts unread Back to top 
abdmaa01
Kilroy

Joined: 20 Mar 2015
Posts: 2

one to give me a hand?
Thank

PostPosted: Sun Mar 22, 2015 10:18 am
 View user's profile Send private message
Reply with quote Mark this and the following posts unread Back to top 
bartmans
Veteran


Joined: 30 Dec 2004
Posts: 97
Location: the Netherlands

Translating this into amino acid code provides:
I V N F R P P V P F T T K N T G R G T A G R G T V L H M A L G Y P T K N N T D M A L G Y P H P V G H K L D L N L G H M A L G Y L L H L N L G R R G Y H T D L N L G R R G Y P T H K N T F I

This shows that there are some repeat sequences (MALGY appears three times, GRRGY twice). Maybe that is of any help?
_________________
Life is just like a game. You know it has to come to an end.

PostPosted: Wed Jul 29, 2015 4:19 am
 View user's profile Send private message
Reply with quote Mark this and the following posts unread Back to top 
Display posts from previous:   Sort by:   
Page 1 of 1 [3 Posts]  
Post new topic   Reply to topic View previous topicMark the topic unreadView next topic
 Forum index » Diversions » TimeWasters
Jump to:  

You cannot post new topics in this forum
You can reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group