Return to Unfiction unforum
 a.r.g.b.b 
 Calendar Calendar   FAQ FAQ   Search Search   Memberlist Memberlist   Usergroups Usergroups 
 Register Register   Log in Log in 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
This week sponsored by:

You?

Why do we need your help?
Announcements
Your continued support keeps uF running!
 
The time now is Wed May 22, 2013 9:13 pm
All times are UTC - 6
View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: Perplex City » PXC: General/Updates
Confirmed solve: location of Receda Cube
Post new topic   Reply to topic View previous topicMark the topic unreadView next topic
Page 9 of 10 [144 Posts]   Goto page: Previous 1, 2, 3, ..., 7, 8, 9, 10  Next
Author Message
somerswey
Greenhorn

Joined: 17 Feb 2007
Posts: 3

FEARLESS and GOOD

Thanks for confirming we were on the right track Rand0m.

We thought we ought to leave something to mark the spot where you found the cube, and the top of a fence post (that we found next to the quadruped) seemed appropriate.

The 4/8/4 could be to do with BOLD/FEARLESS/GOOD but we thought, since it was spinning, that it was pointing us to ribo-nucleaic-acid.

PostPosted: Sun Feb 18, 2007 5:07 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
Agent Lex
Entrenched


Joined: 11 May 2006
Posts: 1188
Location: No longer London, still in England

Re: FEARLESS and GOOD

somerswey wrote:
The 4/8/4 could be to do with BOLD/FEARLESS/GOOD but we thought, since it was spinning, that it was pointing us to ribo-nucleaic-acid.


That would be elegant... if it weren't spelt "nucleic" with 7 letters Razz

PostPosted: Sun Feb 18, 2007 5:11 pm
 View user's profile Send private message Visit poster's website
 Mark this and the following posts unread Back to top 
somerswey
Greenhorn

Joined: 17 Feb 2007
Posts: 3

Never underestimate the power of not being able to spell.

Looks like bold/fearless/good is a better fit.

PostPosted: Sun Feb 18, 2007 5:16 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
Agent Lex
Entrenched


Joined: 11 May 2006
Posts: 1188
Location: No longer London, still in England

Mr Darley, as a web designer I'm surprised you can't see where "bold" came from. I only just got it myself, to be sure.

E and M were indeed highlighted and made bold in Flying. But also, <em> is the replacement html tag for <b>, aka bold. And in "FEMARLEMSSGQQD" both Es are followed by M, making "EM" twice.

D'oh.

PostPosted: Sun Feb 18, 2007 5:31 pm
 View user's profile Send private message Visit poster's website
 Mark this and the following posts unread Back to top 
Rand0m
Decorated


Joined: 14 Mar 2006
Posts: 271
Location: London

Agent Lex wrote:
Mr Darley, as a web designer I'm surprised you can't see where "bold" came from. I only just got it myself, to be sure.

E and M were indeed highlighted and made bold in Flying. But also, <em> is the replacement html tag for , aka bold. And in "FEMARLEMSSGQQD" both Es are followed by M, making "EM" twice.

D'oh.


Thought that myself for a while, but surely <strong> replaces bold and <em> replaces italic?

Fairly convinced there wasn't a Duke of Burgundy called Charles the Italic Smile

Maybe instead the printers' term 'em' for an m-space, a gap between characters the width of a letter m?
_________________
How the Cube was found - my Season One endgame microsite. Arrow

PostPosted: Sun Feb 18, 2007 6:41 pm
 View user's profile Send private message Visit poster's website
 Mark this and the following posts unread Back to top 
rose
...and then Magic happens


Joined: 26 Nov 2003
Posts: 4104

So I googled stong, good (yeah, I'm not smart enough to see GQQD and assumed GOOD -but next time I would) and bold and found the Dukes of Burgandy, but I just don't know if I would have taken the extra step to find the butterflies. I doubt it. I think I would have been put off because I know Burgandy is in France and I would have thought it was taking me away from England.

This is really a long way from the number strings I think. Very complicated puzzle.
_________________
I love this site for being free, in every sense of the word~Spacebass

Mankind was my business, the common good was my business.~ Dickens


PostPosted: Sun Feb 18, 2007 8:06 pm
 View user's profile Send private message Visit poster's website
 Mark this and the following posts unread Back to top 
sixsidedsquare
Unfettered

Joined: 24 Mar 2005
Posts: 409
Location: 60E

Wow, I agree rose, this is a long way from the number strings. Looking at doing it without the LoB hints, I'm not sure how it could be done, unless there were more hints on the cards that completely passed us by. The problem is just that there are so many dead steps on the way that give no indication that you are on the right track.

First of all you start with the number strings, which you might be able to match to the map with the corners of key square if you look hard enough (if you ignore the 2 bits that didn't quite work out). I even tried to do this for a few hours but got disheartened by not even being able to tell if 1=up and coming to lots of random sequences of letters.

Then you had to use the last number of the strings to get the letter from the street and index this list of letters with first numbers of the strings (going 1-2-3-4-1-2- etc) and even shuffle these around a bit to get the right order. And what did that give you? "FRBPULAFHPOSMLUCNIDYMENDBKIELGTPDOAAKILTIO ", a random string of letters.

Next you had to do the whole mod 4 thing to this string, using the 4 specific RNA letters in the right order (Which the cards must have had a hint to somewhere, surely) and this "UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC " a list of random letters, albeit with somewhat less variation. Of course this string could be interpreted as the smaller RNA equivalent giving the "FEMARLEMSSGQQD". And still here there isn't anything outright obvious, you still needed to pick out the 'EM' codes and see that Q's are used for O's, and then google your result.

This was probably the biggest cube finding hint and I guess they couldn't make it easy sure, but looking at it apart from the LoB stuff there had to be some indication of what to do on other cards right? You can't expect someone to rot the vig of a Beale without some sort of instructions or indication they are on the right track. If I gave you "MDEIUGAETOSTYEHSRLOOD" I don't imagine you could tell that you were supposed to convert it to morse with consonants being dots and vowels being dashes, split it up correctly to get letters then take the corresponding letters from the first sentence of this post ala "a=1 - z=26" to find an answer.

Gee I sound to be rambling a bit now, all I'm trying to say is there must have been hints right?

PostPosted: Sun Feb 18, 2007 10:48 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
krystyn
I Never Tire of My Own Voice


Joined: 26 Sep 2002
Posts: 3635
Location: Is not Chicago

Excellently-written story, rand0m.

Congratulations to you! Very Happy
_________________
Alternate Currency
Stories and dreams, crossing my palm like silver.

xbl gamertag: krystyn


PostPosted: Mon Feb 19, 2007 1:43 am
 View user's profile Send private message Visit poster's website
 Mark this and the following posts unread Back to top 
Scribe
Unfettered


Joined: 09 Jun 2006
Posts: 300
Location: Brighton, UK

I second what sixsidedsquare said (+ nice summary there Wink - I'm guessing the second joker card had some kind of big clue that we missed, at least.
_________________
"O, there has been much throwing about of brains."

http://exmosis.net/
http://twitter.com/exmosis/


PostPosted: Mon Feb 19, 2007 5:31 am
 View user's profile Send private message Visit poster's website MSN Messenger
 Mark this and the following posts unread Back to top 
levicc00123
Boot

Joined: 22 Dec 2006
Posts: 16

Re: Puzzle solutions????

PuzzledPineapple wrote:
titi_nicolas wrote:

2) do you really think that the 13th labor can be brute force cracked? From what I read, it could take a *very* long CPU time.
Same thing for Riemann... I am not hoping to get the solution from perlpex city Wink


Join us: http://www.13thlabour.tk Very Happy


do you folks have a linux client.

PostPosted: Mon Feb 19, 2007 7:06 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
ne0x
Veteran


Joined: 30 Jun 2006
Posts: 89
Location: Ottawa, Canada

sixsidedsquare wrote:
If I gave you "MDEIUGAETOSTYEHSRLOOD" I don't imagine you could tell that you were supposed to convert it to morse with consonants being dots and vowels being dashes, split it up correctly to get letters then take the corresponding letters from the first sentence of this post ala "a=1 - z=26" to find an answer.


Now, I've spent some time looking at this, and while I see your point, I gave it at least as half-hearted an attempt as I did the other story puzzles. Wink
You must realise of course that Perplex City has me looking for puzzles everywhere.

Of course, given another hour or so, I could bang together code that would give me all the possible morse-code to letter-number to letters-in-the-first sentence-of-your-post combinations... but I'm not sure you've really hidden something there.
_________________
The Master Theorem Regular
Perplex City Veteran


PostPosted: Mon Feb 19, 2007 7:51 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
ginc
Boot

Joined: 06 Nov 2006
Posts: 56
Location: Germany

Re: Puzzle solutions????

levicc00123 wrote:
do you folks have a linux client.


I'm successfully running the standard client in FC6 with shipped mono. It works perfect. Very Happy

PostPosted: Tue Feb 20, 2007 12:41 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
sixsidedsquare
Unfettered

Joined: 24 Mar 2005
Posts: 409
Location: 60E

ne0x wrote:

Of course, given another hour or so, I could bang together code that would give me all the possible morse-code to letter-number to letters-in-the-first sentence-of-your-post combinations... but I'm not sure you've really hidden something there.


Hee, let me save you an hour or two: 1 3 1 3 4 2 4 3
But what I was trying to get at is that just given the string without the method, I doubt anyone could decode it.


P.S. You'll groan if you decode it.

PostPosted: Tue Feb 20, 2007 5:12 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
rose
...and then Magic happens


Joined: 26 Nov 2003
Posts: 4104

Quote:
But what I was trying to get at is that just given the string without the method, I doubt anyone could decode it.

I don't see how the number strings could have been solved just from the cards. I have trouble even seeing how the first step (numbers to letters) could have been solved from the cards alone. And, I think that the failure of anyone to solve them, despite lots of trying, confirms that impression.

We didn't solve a lot of the META though, so who knows.

Were there any puzzles like this in the cards?

I think that the most obvious way to find the cube from the cards was to figure out the Jurassic strata. I don't think anyone solved that until another clue was given. But in hindsight at least that seems solvable from looking at maps and things. From that, possibly look for all parks or areas within that area that matched the trail pattern given by the End of the Line card. ( I don't think that we had "arboreal" as a hint from the cards, as I recall that came from LoB, the Sentinel and the event where the 3P confirmed it was hidden in a wooded area.) And then just keep searching till you found the right place. Although I know I was put-off by the idea of digging up parkland in NYC- I'm still not sure how that correlates to the laws and rules in the UK - there are parts of Central Park that are less busy than others, so I suppose it could have been done without being caught.
_________________
I love this site for being free, in every sense of the word~Spacebass

Mankind was my business, the common good was my business.~ Dickens


PostPosted: Tue Feb 20, 2007 5:45 pm
 View user's profile Send private message Visit poster's website
 Mark this and the following posts unread Back to top 
makomk
Boot

Joined: 11 Jul 2006
Posts: 56

Rand0m wrote:
Agent Lex wrote:
Mr Darley, as a web designer I'm surprised you can't see where "bold" came from. I only just got it myself, to be sure.

E and M were indeed highlighted and made bold in Flying. But also, <em> is the replacement html tag for , aka bold. And in "FEMARLEMSSGQQD" both Es are followed by M, making "EM" twice.

D'oh.


Thought that myself for a while, but surely <strong> replaces bold and <em> replaces italic?

Fairly convinced there wasn't a Duke of Burgundy called Charles the Italic Smile

Maybe instead the printers' term 'em' for an m-space, a gap between characters the width of a letter m?


Yeah - technically, <em> is logical markup rather than physical and so can reasonably rendered as things other than italic (for example, if the browser can't render italic), but it is generally italic. It probably wouldn't be wise to hire Kurt to design your webpage...

(Incidentally, printers also have an em-dash, IIRC. Not that it probably helps...)
_________________
Violet wrote:
Dad always said nice girls don't eat squid.


PostPosted: Tue Feb 20, 2007 6:11 pm
 View user's profile Send private message
 Mark this and the following posts unread Back to top 
Display posts from previous:   Sort by:   
Page 9 of 10 [144 Posts]   Goto page: Previous 1, 2, 3, ..., 7, 8, 9, 10  Next
Post new topic   Reply to topic View previous topicMark the topic unreadView next topic
 Forum index » Archive » Archive: Perplex City » PXC: General/Updates
Jump to:  

You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group